Review



si traf6  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    MedChemExpress si traf6
    Si Traf6, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm42010017-37-92-153?v=MedChemExpress
    Average 93 stars, based on 1 article reviews
    si traf6 - by Bioz Stars, 2026-07
    93/100 stars

    Images



    Similar Products

    si traf6  (MedChemExpress)
    93
    MedChemExpress si traf6
    Si Traf6, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm42010017-37-92-153?v=MedChemExpress
    Average 93 stars, based on 1 article reviews
    si traf6 - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    lps si traf6 oe txnip groups  (MedChemExpress)
    93
    MedChemExpress lps si traf6 oe txnip groups
    Lps Si Traf6 Oe Txnip Groups, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm42010017-37-82-153?v=MedChemExpress
    Average 93 stars, based on 1 article reviews
    lps si traf6 oe txnip groups - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    si‐traf6 (5'‐ ttctccgaacgtgtcacgtttc‐3  (Sangon Biotech)
    90
    Sangon Biotech si‐traf6 (5'‐ ttctccgaacgtgtcacgtttc‐3
    Si‐Traf6 (5'‐ Ttctccgaacgtgtcacgtttc‐3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/ppr0941862-46-14-2?v=Sangon+Biotech
    Average 90 stars, based on 1 article reviews
    si‐traf6 (5'‐ ttctccgaacgtgtcacgtttc‐3 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    si-traf6  (Ribobio co)
    90
    Ribobio co si-traf6
    Si Traf6, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm36493861-78-21-25?v=Ribobio+co
    Average 90 stars, based on 1 article reviews
    si-traf6 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    small interfering (si)rna against traf6  (Ribobio co)
    90
    Ribobio co small interfering (si)rna against traf6
    Small Interfering (Si)rna Against Traf6, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/ppr0230915-70-7-11?v=Ribobio+co
    Average 90 stars, based on 1 article reviews
    small interfering (si)rna against traf6 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    si-traf6  (Shanghai GenePharma)
    90
    Shanghai GenePharma si-traf6
    Si Traf6, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm29377244-55-8-23?v=Shanghai+GenePharma
    Average 90 stars, based on 1 article reviews
    si-traf6 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    si-traf6 small interference oligonucleotide  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology si-traf6 small interference oligonucleotide
    Si Traf6 Small Interference Oligonucleotide, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm23146644-80-13-27?v=Santa+Cruz+Biotechnology
    Average 90 stars, based on 1 article reviews
    si-traf6 small interference oligonucleotide - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    traf6 small interfering (si)rna oligo ccacgaagagauaauggaudtdt  (Qiagen)
    90
    Qiagen traf6 small interfering (si)rna oligo ccacgaagagauaauggaudtdt
    Traf6 Small Interfering (Si)rna Oligo Ccacgaagagauaauggaudtdt, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/si+traf6/pm18070982-40-4-11?v=Qiagen
    Average 90 stars, based on 1 article reviews
    traf6 small interfering (si)rna oligo ccacgaagagauaauggaudtdt - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results